Display Settings:

Format

Send to:

Choose Destination
Pr012415334

Homo sapiens STS probe bac5129T

Synopsis

Field NameValues
Namebac5129T
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:181440

Sequences

>Probe|12415334|PRIMERF Forward PCR primer (outermost) (23b)
CTTGGATACAAGTCCAATGTCCA
>Probe|12415334|PRIMERR Reverse PCR primer (outermost) (26b)
AGTTGATTCTTGTTATTCACAGTGGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmbac5129T

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID181440
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center