Display Settings:

Format

Send to:

Choose Destination
Pr012415256

Homo sapiens STS probe stbA304N7SP6

Synopsis

Field NameValues
NamestbA304N7SP6
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:181370

Sequences

>Probe|12415256|PRIMERF Forward PCR primer (outermost) (22b)
ATATTTTTCCCTGAGATGCAGC
>Probe|12415256|PRIMERR Reverse PCR primer (outermost) (22b)
ATTTTTGCAGCTGTTTTTTGTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmstbA304N7SP6

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID181370
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center