Display Settings:

Format

Send to:

Choose Destination
Pr012414931

STS probe AI854243 for paroxysmal nonkinesigenic dyskinesia (PNKD) and 25 more genes

Synopsis

Field NameValues
NameAI854243
Alias675220
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100130470; PNKD; Pnkd; PNKD; PNKD; PNKD; PNKDP1; LOC100508653; LOC100583918; ARPC2; LOC100599615; LOC100621513; Pnkd; PNKDMore
UniSTS IDUniSTS:181078

Sequences

>Probe|12414931|PRIMERF Forward PCR primer (outermost) (20b)
AATCGGTCCTTGTCCACTTC
>Probe|12414931|PRIMERR Reverse PCR primer (outermost) (20b)
TACATTCCCAGAAAGAGGGG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5500244
UniSTS IDcontext specific help for: UniSTS ID181078
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center