Display Settings:

Format

Send to:

Choose Destination
Pr012413821

STS probe AW209082 for transcription factor 3 (Tcf3) and 2 more genes

Synopsis

Field NameValues
NameAW209082
Alias859309
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target genesLOC100364490; Tcf3; Tcf3
UniSTS IDUniSTS:180078

Sequences

>Probe|12413821|PRIMERF Forward PCR primer (outermost) (20b)
GTGCTGGTGGCTCTGAAGTA
>Probe|12413821|PRIMERR Reverse PCR primer (outermost) (20b)
GAACTGGAAACAAAGCAGCA

References

1.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculusradiation hybridWI/MRC-RH10918.81 cr859309

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5027407
UniSTS IDcontext specific help for: UniSTS ID180078
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center