Display Settings:

Format

Send to:

Choose Destination
Pr012412735

STS probe AI853647 for 5-hydroxytryptamine (serotonin) receptor 1D (Htr1d)

Synopsis

Field NameValues
NameAI853647
Alias674624
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target geneHtr1d
UniSTS IDUniSTS:179100

Sequences

>Probe|12412735|PRIMERF Forward PCR primer (outermost) (20b)
AACTCCAAGGACAAGGGTTG
>Probe|12412735|PRIMERR Reverse PCR primer (outermost) (20b)
TTCCGAAGTTAAAACCCACC

References

1.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculusradiation hybridWI/MRC-RH41802.48 cr674624

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID179100
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center