Display Settings:

Format

Send to:

Choose Destination
Pr012408657

STS probe SHGC-31078 for sprouty related EVH1 domain containing 2 (SPRED2) and 3 more genes

Synopsis

Field NameValues
NameSHGC-31078
AliasRH14670
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSPRED2; SPRED2; SPRED2; SPRED2
UniSTS IDUniSTS:17543

Sequences

>Probe|12408657|PRIMERF Forward PCR primer (outermost) (21b)
ATACTCTCATCTTCTCCCCCG
>Probe|12408657|PRIMERR Reverse PCR primer (outermost) (20b)
GGGGAGTGGAGAGTCTACCC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G322941 cr10000SHGC-31078
Homo sapiensradiation hybridGeneMap99-G322852 cr10000SHGC-31078
Homo sapienslinkageRutgers Map2 cmSHGC-31078

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID17543
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center