Display Settings:

Format

Send to:

Choose Destination
Pr012408568

STS probe D20S525E for hypothetical LOC100505632 (LOC100505632)

Synopsis

Field NameValues
NameD20S525E
AliasesRH12181; WIAF-2112; WIAF-2112-STS; stSG3031
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneLOC100505632
UniSTS IDUniSTS:17535

Sequences

>Probe|12408568|PRIMERF Forward PCR primer (outermost) (19b)
ATACTCACGGGGGCTGAAG
>Probe|12408568|PRIMERR Reverse PCR primer (outermost) (20b)
AGCTATGCTGCCCAGATGTC

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB420106.71 cr3000stSG3031
Homo sapienslinkageRutgers Map20 cmD20S525E
Homo sapiensradiation hybridNCBI RH20149.6 crstSG3031

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID17535
Probe Cross-refcontext specific help for: Probe Cross-refGDB:441087
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center