Display Settings:

Format

Send to:

Choose Destination
Pr012407180

STS probe DXS9722 for 60S ribosomal protein L28 pseudogene (LOC465479) and 1 more gene

Synopsis

Field NameValues
NameDXS9722
AliasesRH34821; SHGC-6734
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC465479; LOC740687
UniSTS IDUniSTS:1741

Sequences

>Probe|12407180|PRIMERF Forward PCR primer (outermost) (21b)
AAAGTTCAGGTTCTCATCTGG
>Probe|12407180|PRIMERR Reverse PCR primer (outermost) (20b)
TCAGACCTTGAATCAGAAGC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3X717 cr10000SHGC-6734
Homo sapienslinkageRutgers MapX cmDXS9722

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID1741
Probe Cross-refcontext specific help for: Probe Cross-refGDB:737629
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center