Display Settings:

Format

Send to:

Choose Destination
Pr012406691

STS probe G19828 for CKLF like MARVEL transmembrane domain containing 3 (CMTM3) and 2 more genes

Synopsis

Field NameValues
NameG19828
AliasA001Z40
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCMTM3; CMTM3; CMTM3
UniSTS IDUniSTS:17366

Sequences

>Probe|12406691|PRIMERF Forward PCR primer (outermost) (21b)
ATACAATACCCAACAGTATTG
>Probe|12406691|PRIMERR Reverse PCR primer (outermost) (21b)
ATTTGTAGCCTTATTCTCTTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map16 cmG19828

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID17366
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center