Display Settings:

Format

Send to:

Choose Destination
Pr012403036

STS probe D2S2608 for ALMS1, centrosome and basal body associated protein (ALMS1) and 2 more genes

Synopsis

Field NameValues
NameD2S2608
AliasesMH490; WI-826
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesALMS1; ALMS1; ALMS1
UniSTS IDUniSTS:17037

Sequences

>Probe|12403036|PRIMERF Forward PCR primer (outermost) (22b)
ATAAAAAACAGGAAAAGATGGG
>Probe|12403036|PRIMERR Reverse PCR primer (outermost) (21b)
TTCTCATCTATGTGACAGGGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmD2S2608

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID17037
Probe Cross-refcontext specific help for: Probe Cross-refGDB:372505
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center