Display Settings:

Format

Send to:

Choose Destination
Pr012399563

STS probe D18Ertd734e for adenomatosis polyposis coli (Apc)

Synopsis

Field NameValues
NameD18Ertd734e
TypeSTS
Application
Source organism
Source sequence
Target geneApc
UniSTS IDUniSTS:167243

Sequences

>Probe|12399563|PRIMERF Forward PCR primer (outermost) (26b)
TTAATAAAGGGAAACAACAGAAATAT
>Probe|12399563|PRIMERR Reverse PCR primer (outermost) (19b)
AGTCATGGGGTCTTGACTA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:1862952
UniSTS IDcontext specific help for: UniSTS ID167243
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center