Display Settings:

Format

Send to:

Choose Destination
Pr012399348

STS probe DXS9763 for sushi repeat containing protein, X-linked 2 (SRPX2) and 5 more genes

Synopsis

Field NameValues
NameDXS9763
AliasesRH7944; SHGC-13881
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSYTL4; SRPX2; SRPX2; SYTL4; SYTL4; SYTL4
UniSTS IDUniSTS:16705

Sequences

>Probe|12399348|PRIMERF Forward PCR primer (outermost) (18b)
AGTTACAGCCCGGGATCC
>Probe|12399348|PRIMERR Reverse PCR primer (outermost) (25b)
AACTGATTTCCTATAAGCACACTGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3X3240 cr10000SHGC-13881
Homo sapiensradiation hybridGeneMap99-G3X3261 cr10000SHGC-13881
Homo sapienslinkageRutgers MapX cmDXS9763

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID16705
Probe Cross-refcontext specific help for: Probe Cross-refGDB:737764; GDB:738745
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center