Display Settings:

Format

Send to:

Choose Destination
Pr012399170

STS probe G66694 for PHD finger protein 6 (PHF6)

Synopsis

Field NameValues
NameG66694
AliasXq4055
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genePHF6
UniSTS IDUniSTS:166890

Sequences

>Probe|12399170|PRIMERF Forward PCR primer (outermost) (24b)
GACCTGCCCGGTGTCCAGAGTCAT
>Probe|12399170|PRIMERR Reverse PCR primer (outermost) (26b)
TCCTACCCTGCCTCTTTGCTAAGCAA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmG66694

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID166890
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center