Display Settings:

Format

Send to:

Choose Destination
Pr012399038

STS probe G66898 for interleukin 1 receptor accessory protein like 1 (IL1RAPL1) and 1 more gene

Synopsis

Field NameValues
NameG66898
AliasG-107952
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesIL1RAPL1; IL1RAPL1
UniSTS IDUniSTS:166771

Sequences

>Probe|12399038|PRIMERF Forward PCR primer (outermost) (23b)
GGTCAATTTGGGAAAGAATGACA
>Probe|12399038|PRIMERR Reverse PCR primer (outermost) (23b)
GCCACACTTTTTGGAAATTCAAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmG66898

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID166771
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center