Display Settings:

Format

Send to:

Choose Destination
Pr012398430

STS probe Htr5a for 5-hydroxytryptamine (serotonin) receptor 5A (Htr5a)

Synopsis

Field NameValues
NameHtr5a
TypeSTS
Application
Source organism
Source sequence
Target geneHtr5a
UniSTS IDUniSTS:166223

Sequences

>Probe|12398430|PRIMERF Forward PCR primer (outermost) (20b)
GCACTAGCTGAGTTCTGGGC
>Probe|12398430|PRIMERR Reverse PCR primer (outermost) (20b)
AGGGGCTGAATCTAGAAGCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:1860239
UniSTS IDcontext specific help for: UniSTS ID166223
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center