Display Settings:

Format

Send to:

Choose Destination
Pr012397163

STS probe AW212393 for 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (Atic) and 1 more gene

Synopsis

Field NameValues
NameAW212393
Alias862620
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target genesLOC100046995; Atic
UniSTS IDUniSTS:165083

Sequences

>Probe|12397163|PRIMERF Forward PCR primer (outermost) (20b)
CTGCTCACTTTGGGTGAAAA
>Probe|12397163|PRIMERR Reverse PCR primer (outermost) (20b)
ATGCTGGGACTGCTCTTTCT

References

1.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculusradiation hybridWI/MRC-RH1983.5 cr862620

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID165083
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center