Display Settings:

Format

Send to:

Choose Destination
Pr012396970

Homo sapiens STS probe D9S1783

Synopsis

Field NameValues
NameD9S1783
AliasesA136VD1; AFMA136VD1; AFMa136vd1; HSA136VD1; W5482
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:16491

Sequences

>Probe|12396970|PRIMERF Forward PCR primer (outermost) (19b)
AGTGGAACTCAGCACAAGG
>Probe|12396970|PRIMERR Reverse PCR primer (outermost) (23b)
TTAACAACTCAAAAGACAGGAAG

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map9 cmD9S1783
Homo sapienslinkageMarshfield9105.02 cmAFMa136vd1
Homo sapienslinkageGenethon9104.9 cmAFMa136vd1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID16491
Probe Cross-refcontext specific help for: Probe Cross-refGDB:603452
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center