Display Settings:

Format

Send to:

Choose Destination
Pr012396807

Homo sapiens STS probe G64768

Synopsis

Field NameValues
NameG64768
AliasB185J11.GSS/T7
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:164762

Sequences

>Probe|12396807|PRIMERF Forward PCR primer (outermost) (21b)
CTAATCCTCCCTTCTGGTTGG
>Probe|12396807|PRIMERR Reverse PCR primer (outermost) (19b)
ATAATTCATTGTTCTGGCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmG64768

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID164762
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center