Display Settings:

Format

Send to:

Choose Destination
Pr012396732

STS probe Ppara for peroxisome proliferator activated receptor alpha (Ppara) and 1 more gene

Synopsis

Field NameValues
NamePpara
TypeSTS
Application
Source organism
Source sequence
Target genesPpara; Ppara
UniSTS IDUniSTS:164695

Sequences

>Probe|12396732|PRIMERF Forward PCR primer (outermost) (22b)
GCGGCCCCATACAGGAGAGCAG
>Probe|12396732|PRIMERR Reverse PCR primer (outermost) (24b)
CTAACCTTGGGCCACACCTTGACT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center