Display Settings:

Format

Send to:

Choose Destination
Pr012395496

STS probe AF061934 for regulator of G-protein signaling 11 (Rgs11)

Synopsis

Field NameValues
NameAF061934
Alias418146
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target geneRgs11
UniSTS IDUniSTS:163582

Sequences

>Probe|12395496|PRIMERF Forward PCR primer (outermost) (20b)
AGGAAGGCTCCTCCACTGTA
>Probe|12395496|PRIMERR Reverse PCR primer (outermost) (20b)
AGCTGATCAGACGACAGGTG

References

1.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculusradiation hybridWI/MRC-RH17329.02 cr418146

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID163582
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center