Display Settings:

Format

Send to:

Choose Destination
Pr012395225

STS probe UniSTS:163337 for matrix metallopeptidase 16 (MMP16) and 11 more genes

Synopsis

Field NameValues
NameUniSTS:163337
AliasesAB021228; 685506
TypeSTS
Application
Source organism
Source sequence
Target organismsMus musculus; Homo sapiens
Target genesMMP16; MMP16; MMP16; MMP16; MMP16; MMP16; Mmp16; MMP16; MMP16; Mmp16; MMP16; MMP16
UniSTS IDUniSTS:163337

Sequences

>Probe|12395225|PRIMERF Forward PCR primer (outermost) (20b)
GAGTGGGTGTGATGTAGGGA
>Probe|12395225|PRIMERR Reverse PCR primer (outermost) (20b)
CTGGTTTGAAAGGTCAGCCT

References

1.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map8 cmUniSTS:163337
Mus musculusradiation hybridWI/MRC-RH4302.08 cr685506

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID163337
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5032207
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center