Display Settings:

Format

Send to:

Choose Destination
Pr012395120

STS probe G49211 for ubiquitin specific peptidase 9, Y-linked (USP9Y) and 2 more genes

Synopsis

Field NameValues
NameG49211
AliassY745
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100130216; USP9Y; USP9Y
UniSTS IDUniSTS:163242

Sequences

>Probe|12395120|PRIMERF Forward PCR primer (outermost) (21b)
CAGTGACACATCAGATTAAGC
>Probe|12395120|PRIMERR Reverse PCR primer (outermost) (21b)
GTCCAAGTTCCAGCCTAGACC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID163242
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center