Display Settings:

Format

Send to:

Choose Destination
Pr012393477

STS probe RH124941 for RIKEN cDNA 4930402H24 gene (4930402H24Rik)

Synopsis

Field NameValues
NameRH124941
TypeSTS
Application
Source organism
Source sequence
Target gene4930402H24Rik
UniSTS IDUniSTS:161763

Sequences

>Probe|12393477|PRIMERF Forward PCR primer (outermost) (20b)
CGGCATATACCATGTTTAGC
>Probe|12393477|PRIMERR Reverse PCR primer (outermost) (17b)
GCTGTGAAGACATCCCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID161763
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center