Display Settings:

Format

Send to:

Choose Destination
Pr012393290

STS probe RH124773 for solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 (Slc7a8) and 1 more gene

Synopsis

Field NameValues
NameRH124773
TypeSTS
Application
Source organism
Source sequence
Target genesSlc7a8; Slc7a8
UniSTS IDUniSTS:161595

Sequences

>Probe|12393290|PRIMERF Forward PCR primer (outermost) (20b)
TCCAAAAAGTAAGGCATCCA
>Probe|12393290|PRIMERR Reverse PCR primer (outermost) (17b)
AGTCCAGGCAGGCTGTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5502417
UniSTS IDcontext specific help for: UniSTS ID161595
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center