Display Settings:

Format

Send to:

Choose Destination
Pr012392962

STS probe D15S1248 for ADAM metallopeptidase domain 10 (ADAM10)

Synopsis

Field NameValues
NameD15S1248
AliasesRH29743; RH95901; SHGC-14439
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneADAM10
UniSTS IDUniSTS:1613

Sequences

>Probe|12392962|PRIMERF Forward PCR primer (outermost) (25b)
AAAGGTACTTGGAACTTTTGAATTG
>Probe|12392962|PRIMERR Reverse PCR primer (outermost) (25b)
GCCTTTCCTACTTTCTAAACATTTG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3151771 cr10000SHGC-14439
Homo sapiensradiation hybridTNG1520692 cr50000SHGC-14439
Homo sapienslinkageRutgers Map15 cmD15S1248
Homo sapiensradiation hybridNCBI RH15291 crSHGC-14439

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID1613
Probe Cross-refcontext specific help for: Probe Cross-refGDB:736212
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center