Display Settings:

Format

Send to:

Choose Destination
Pr012391422

STS probe AI447572 for phosphatidylinositol 3-kinase, catalytic, beta polypeptide (Pik3cb)

Synopsis

Field NameValues
NameAI447572
Alias430369
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target genePik3cb
UniSTS IDUniSTS:159912

Sequences

>Probe|12391422|PRIMERF Forward PCR primer (outermost) (20b)
TCCCACATGTCTTTGGAGAA
>Probe|12391422|PRIMERR Reverse PCR primer (outermost) (20b)
TCATGCCACATGGAAATCTT

References

1.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculusradiation hybridWI/MRC-RH91009.81 cr430369

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID159912
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center