Display Settings:

Format

Send to:

Choose Destination
Pr012390470

STS probe C76846 for charged multivesicular body protein 4B (Chmp4b) and 1 more gene

Synopsis

Field NameValues
NameC76846
Alias251424
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target genesLOC674706; Chmp4b
UniSTS IDUniSTS:159055

Sequences

>Probe|12390470|PRIMERF Forward PCR primer (outermost) (20b)
ATCCGTGTCACAAACTCCAA
>Probe|12390470|PRIMERR Reverse PCR primer (outermost) (20b)
CAGTTGAAGCGAACTGGAAA

References

1.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculusradiation hybridWI/MRC-RH21809.77 cr251424

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID159055
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center