Display Settings:

Format

Send to:

Choose Destination
Pr012389831

STS probe GDB:632624 for elongation factor 1-alpha 1-like (LOC100156563) and 5 more genes

Synopsis

Field NameValues
NameGDB:632624
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100156563; Eef1a1; LOC100732520; LOC100770366; Dnm3; LOC100774113
UniSTS IDUniSTS:158480

Sequences

>Probe|12389831|PRIMERF Forward PCR primer (outermost) (19b)
CATTAAGAAAATTGGCTAC
>Probe|12389831|PRIMERR Reverse PCR primer (outermost) (20b)
ATTGAAGCCCACATTGTCCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID158480
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center