Display Settings:

Format

Send to:

Choose Destination
Pr012389774

STS probe GDB:631802 for predicted gene 4933 (Gm4933)

Synopsis

Field NameValues
NameGDB:631802
TypeSTS
Application
Source organism
Source sequence
Target geneGm4933
UniSTS IDUniSTS:158429

Sequences

>Probe|12389774|PRIMERF Forward PCR primer (outermost) (23b)
CCTGTAATCCCAGCACTTTGGGA
>Probe|12389774|PRIMERR Reverse PCR primer (outermost) (22b)
CCTGTAATCCCAGCACTTTGGG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5502214
UniSTS IDcontext specific help for: UniSTS ID158429
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center