Display Settings:

Format

Send to:

Choose Destination
Pr012389091

STS probe GDB:577662 for collagen type II alpha 1 chain (COL2A1) and 6 more genes

Synopsis

Field NameValues
NameGDB:577662
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCOL2A1; COL2A1; LOC100621630; COL2A1; COL2A1; COL2A1; COL2A1
UniSTS IDUniSTS:157814

Sequences

>Probe|12389091|PRIMERF Forward PCR primer (outermost) (20b)
CATTGCTGGTGCTCCTGGCT
>Probe|12389091|PRIMERR Reverse PCR primer (outermost) (20b)
ACCAGCATCACCAGGGCGGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmGDB:577662

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID157814
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center