Display Settings:

Format

Send to:

Choose Destination
Pr012388892

STS probe GDB:549217 for alkaline phosphatase, liver/bone/kidney (ALPL) and 5 more genes

Synopsis

Field NameValues
NameGDB:549217
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesALPL; ALPL; ALPL; ALPL; ALPL; ALPL
UniSTS IDUniSTS:157635

Sequences

>Probe|12388892|PRIMERF Forward PCR primer (outermost) (20b)
GGAAATCTGTGGGCATTGTG
>Probe|12388892|PRIMERR Reverse PCR primer (outermost) (20b)
CCCTGATGTTATGCATGAGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmGDB:549217

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID157635
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center