Display Settings:

Format

Send to:

Choose Destination
Pr012388652

STS probe GDB:454059 for phenylalanine hydroxylase (PAH)

Synopsis

Field NameValues
NameGDB:454059
TypeSTS
Application
Source organism
Source sequence
Target genePAH
UniSTS IDUniSTS:157419

Sequences

>Probe|12388652|PRIMERF Forward PCR primer (outermost) (22b)
CTAACCCTGCATTCTGCTGTGC
>Probe|12388652|PRIMERR Reverse PCR primer (outermost) (21b)
CATACTTGTCTTCCCCTTCCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID157419
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center