Display Settings:

Format

Send to:

Choose Destination
Pr012388441

STS probe GDB:435459 for potassium voltage-gated channel subfamily A member 1 (KCNA1) and 14 more genes

Synopsis

Field NameValues
NameGDB:435459
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesKCNA1; KCNA1; KCNA1; LOC100153675; KCNA1; KCNA1; KCNA1; KCNA1; LOC100586756; Kcna1; KCNA1; KCNA1; KCNA1; KCNA1More
UniSTS IDUniSTS:157229

Sequences

>Probe|12388441|PRIMERF Forward PCR primer (outermost) (23b)
TTAAACATCGGTCAGTAGCTTGC
>Probe|12388441|PRIMERR Reverse PCR primer (outermost) (20b)
CCAGCAAGACGGACTTCTTC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmGDB:435459

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID157229
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center