Display Settings:

Format

Send to:

Choose Destination
Pr012388183

STS probe GDB:375093

Synopsis

Field NameValues
NameGDB:375093
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:156998

Sequences

>Probe|12388183|PRIMERF Forward PCR primer (outermost) (20b)
AGGCCTACCAGTCAGTTCTT
>Probe|12388183|PRIMERR Reverse PCR primer (outermost) (20b)
GGTACACCTTGTTCTTCTCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID156998
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center