Display Settings:

Format

Send to:

Choose Destination
Pr012388011

STS probe GDB:371366 for 5-hydroxytryptamine receptor 1D (HTR1D) and 12 more genes

Synopsis

Field NameValues
NameGDB:371366
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesHTR1D; HTR1D; HTR1D; HTR1D; HTR1D; LOC100708195; LOC100739392; Htr1d; HTR1D; HTR1D; HTR1D; HTR1D; HTR1D
UniSTS IDUniSTS:156842

Sequences

>Probe|12388011|PRIMERF Forward PCR primer (outermost) (20b)
ACCAGGAAGCTCCACACCCC
>Probe|12388011|PRIMERR Reverse PCR primer (outermost) (20b)
GCCTTGGCCTGCCGCCAGAA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmGDB:371366

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID156842
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center