Display Settings:

Format

Send to:

Choose Destination
Pr012387960

STS probe GDB:364012

Synopsis

Field NameValues
NameGDB:364012
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:156797

Sequences

>Probe|12387960|PRIMERF Forward PCR primer (outermost) (20b)
GACCCCGCTGCACAGTCCGG
>Probe|12387960|PRIMERR Reverse PCR primer (outermost) (20b)
CACATTGGCATGCAGGATTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID156797
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center