Display Settings:

Format

Send to:

Choose Destination
Pr012387886

STS probe DXS8296 for zinc finger protein 791-like (LOC100426713) and 1 more gene

Synopsis

Field NameValues
NameDXS8296
AliasesHUMSWX1845; I295C9; RH30022; SHGC-16304; sWXD1845
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100426713; LOC100591290
UniSTS IDUniSTS:15673

Sequences

>Probe|12387886|PRIMERF Forward PCR primer (outermost) (24b)
AGGTGATTATACATACAAGATGAG
>Probe|12387886|PRIMERR Reverse PCR primer (outermost) (24b)
TCCATCCAAACAACAAACAATAAC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content.

Nagaraja R, MacMillan S, Kere J, Jones C, Griffin S, Schmatz M, Terrell J, Shomaker M, Jermak C, Hott C, Masisi M, Mumm S, Srivastava A, Pilia G, Featherstone T, Mazzarella R, Kesterson S, McCauley B, Railey B, Burough F, Nowotny V, D'Urso M, States D, Brownstein B, Schlessinger D.

Genome Res. 1997 Mar;7(3):210-22.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3X3417 cr10000SHGC-16304
Homo sapienslinkageRutgers MapX cmDXS8296
Homo sapiensphysicalWUSTL-XX6.7 ordinalsWXD1845
Homo sapiensradiation hybridNCBI RHX586.7 crSHGC-16304

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID15673
Probe Cross-refcontext specific help for: Probe Cross-refGDB:677324
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center