Display Settings:

Format

Send to:

Choose Destination
Pr012387720

STS probe GDB:316876 for tumor protein p53 (TP53) and 11 more genes

Synopsis

Field NameValues
NameGDB:316876
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100134328; LOC100427526; LOC100506809; LOC100509912; TP53; WRAP53; TP53; WRAP53; TP53; WRAP53; TP53; LOC750631
UniSTS IDUniSTS:156580

Sequences

>Probe|12387720|PRIMERF Forward PCR primer (outermost) (20b)
TTCCGCAGTTTCTTCCCATG
>Probe|12387720|PRIMERR Reverse PCR primer (outermost) (20b)
TGTGTGTAAATGCCACCTCG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmGDB:316876

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID156580
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center