Display Settings:

Format

Send to:

Choose Destination
Pr012386458

STS probe GDB:185282 for apolipoprotein B (APOB) and 3 more genes

Synopsis

Field NameValues
NameGDB:185282
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100441745; APOB; APOB; APOB
UniSTS IDUniSTS:155444

Sequences

>Probe|12386458|PRIMERF Forward PCR primer (outermost) (30b)
CAGGAACTGTTGACTCAGGAAGGCCAAGCC
>Probe|12386458|PRIMERR Reverse PCR primer (outermost) (30b)
AGCAACTAACAGGTTCTTGATCAGACTGAC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmGDB:185282

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID155444
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center