Display Settings:

Format

Send to:

Choose Destination
Pr012386128

STS probe GDB:180968 for erb-b2 receptor tyrosine kinase 2 (ERBB2) and 5 more genes

Synopsis

Field NameValues
NameGDB:180968
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesERBB2; ERBB2; ERBB2; ERBB2; ERBB2; ERBB2
UniSTS IDUniSTS:155147

Sequences

>Probe|12386128|PRIMERF Forward PCR primer (outermost) (15b)
CTGGAATGGGAAGCA
>Probe|12386128|PRIMERR Reverse PCR primer (outermost) (23b)
GCCAGCAAAGAAATCTTAGACGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmGDB:180968

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID155147
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center