Display Settings:

Format

Send to:

Choose Destination
Pr012386016

STS probe GDB:179433 for insulin (INS) and 4 more genes

Synopsis

Field NameValues
NameGDB:179433
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesINS; INS; INS; INS; INS-IGF2
UniSTS IDUniSTS:155046

Sequences

>Probe|12386016|PRIMERF Forward PCR primer (outermost) (21b)
GCTGGTTCAAGGGCTTTATTC
>Probe|12386016|PRIMERR Reverse PCR primer (outermost) (21b)
TGGGGCAGGTGGAGCTGGGCG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmGDB:179433

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID155046
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center