Display Settings:

Format

Send to:

Choose Destination
Pr012385978

STS probe GDB:178434 for phenylalanine hydroxylase (PAH) and 5 more genes

Synopsis

Field NameValues
NameGDB:178434
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPAH; PAH; PAH; PAH; PAH; PAH
UniSTS IDUniSTS:155011

Sequences

>Probe|12385978|PRIMERF Forward PCR primer (outermost) (22b)
CCCAAACCTCATTCTTGCAGCA
>Probe|12385978|PRIMERR Reverse PCR primer (outermost) (20b)
CTTGCACTGGTTTCCGCCTC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmGDB:178434

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID155011
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center