Display Settings:

Format

Send to:

Choose Destination
Pr012385688

STS probe D14S1420 for immunoglobulin heavy locus (IGH) and 3 more genes

Synopsis

Field NameValues
NameD14S1420
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100508392; IGHV1-67; IGH; LOC652146
UniSTS IDUniSTS:154751

Sequences

>Probe|12385688|PRIMERF Forward PCR primer (outermost) (20b)
TGTTTGAAGAAGGGAGTCGT
>Probe|12385688|PRIMERR Reverse PCR primer (outermost) (20b)
CCCACTCCATGTCTTCTGTT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map14 cmD14S1420

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID154751
Probe Cross-refcontext specific help for: Probe Cross-refGDB:682412
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center