Display Settings:

Format

Send to:

Choose Destination
Pr012385049

STS probe D22S1128 for fucosyltransferase 8 (FUT8) and 4 more genes

Synopsis

Field NameValues
NameD22S1128
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesFUT8; FUT8; FUT8; FUT8; FUT8
UniSTS IDUniSTS:154173

Sequences

>Probe|12385049|PRIMERF Forward PCR primer (outermost) (20b)
GTCCAGAAACATTGAGTACT
>Probe|12385049|PRIMERR Reverse PCR primer (outermost) (20b)
GCATCAGTTCATTGACCTCA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map14 cmD22S1128

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID154173
Probe Cross-refcontext specific help for: Probe Cross-refGDB:596583
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center