Display Settings:

Format

Send to:

Choose Destination
Pr012384882

STS probe D12S1525E for PTPRF interacting protein alpha 2 (PPFIA2) and 2 more genes

Synopsis

Field NameValues
NameD12S1525E
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPPFIA2; PPFIA2; PPFIA2
UniSTS IDUniSTS:154022

Sequences

>Probe|12384882|PRIMERF Forward PCR primer (outermost) (22b)
TAAGTACTCAGCTTTCTGAATG
>Probe|12384882|PRIMERR Reverse PCR primer (outermost) (20b)
GGCTAAAAATGAGAAAGAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmD12S1525E

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID154022
Probe Cross-refcontext specific help for: Probe Cross-refGDB:595606
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center