Display Settings:

Format

Send to:

Choose Destination
Pr012384567

Homo sapiens STS probe D14S1163

Synopsis

Field NameValues
NameD14S1163
AliasesRH35465; SHGC-9515
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:15374

Sequences

>Probe|12384567|PRIMERF Forward PCR primer (outermost) (19b)
AGGGGCTGGAGATTGATTG
>Probe|12384567|PRIMERR Reverse PCR primer (outermost) (21b)
GAGACAAGTGGGATAGGAGGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G314499 cr10000SHGC-9515
Homo sapienslinkageRutgers Map14 cmD14S1163
Homo sapiensradiation hybridNCBI RH1448.2 crSHGC-9515

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID15374
Probe Cross-refcontext specific help for: Probe Cross-refGDB:638230
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center