Display Settings:

Format

Send to:

Choose Destination
Pr012384145

STS probe D16S2786 for G protein subunit alpha o1 (GNAO1) and 2 more genes

Synopsis

Field NameValues
NameD16S2786
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesGNAO1; GNAO1; GNAO1
UniSTS IDUniSTS:153356

Sequences

>Probe|12384145|PRIMERF Forward PCR primer (outermost) (20b)
CGTGTGGATTATGTGAAGTG
>Probe|12384145|PRIMERR Reverse PCR primer (outermost) (20b)
AAAACCTTCCAAGGACAGAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map16 cmD16S2786

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID153356
Probe Cross-refcontext specific help for: Probe Cross-refGDB:567780
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center