Display Settings:

Format

Send to:

Choose Destination
Pr012382220

STS probe D15S728E for RAB11A, member RAS oncogene family (RAB11A) and 1 more gene

Synopsis

Field NameValues
NameD15S728E
TypeSTS
Application
Source organism
Source sequence
Target genesRAB11A; RAB11A
UniSTS IDUniSTS:151622

Sequences

>Probe|12382220|PRIMERF Forward PCR primer (outermost) (22b)
CATGGCTAACTATTCAGGAGAC
>Probe|12382220|PRIMERR Reverse PCR primer (outermost) (20b)
GTGCTGGGATTAAAGGCGTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:446991
UniSTS IDcontext specific help for: UniSTS ID151622
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center