Display Settings:

Format

Send to:

Choose Destination
Pr012381993

STS probe D11S2305E for intraflagellar transport 46 (IFT46) and 2 more genes

Synopsis

Field NameValues
NameD11S2305E
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesIFT46; IFT46; TMEM25
UniSTS IDUniSTS:151418

Sequences

>Probe|12381993|PRIMERF Forward PCR primer (outermost) (18b)
ATGTCCTGCTGCCCTCTC
>Probe|12381993|PRIMERR Reverse PCR primer (outermost) (22b)
CTTTCCTCCCAATCTAACCTCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmD11S2305E

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID151418
Probe Cross-refcontext specific help for: Probe Cross-refGDB:445896
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center