Display Settings:

Format

Send to:

Choose Destination
Pr012381981

STS probe D11S2246E for succinate dehydrogenase complex subunit D (SDHD) and 3 more genes

Synopsis

Field NameValues
NameD11S2246E
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSDHD; SDHD; SDHD; SDHD
UniSTS IDUniSTS:151407

Sequences

>Probe|12381981|PRIMERF Forward PCR primer (outermost) (22b)
TGGTTTTGTAGGACTGGTTAGG
>Probe|12381981|PRIMERR Reverse PCR primer (outermost) (22b)
GAGGAAGTGGAGCACATTATAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmD11S2246E

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID151407
Probe Cross-refcontext specific help for: Probe Cross-refGDB:445698
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center